Back to Gatefold
Issue #3 by Brad Horton
Dec 2015 |
Salem Center.
Adam walked down a long corridor with the X-Men’s subbasement, located deep under the mansion. The seams of the walls, ceilings, and floor were clean, the colors were a subtle metallic blue. The lights were bright, but soft and calm. They hummed ever so slightly.
At the end of the hall was the Cerebro chamber. The mutant-tracking and operating system was accessible from various hubs throughout the mansion, but Adam needed the main hub for an uninterrupted—and untraceable—session. With Cerebro at his fingertips, he could track the entire Clan Akkaba, provided they were not blocking their psi-patterns.
The X-Men were too ethical to use Cerebro in such a voyeuristic nature. If they were not as ethical, they could preemptively attack and stop their enemies.
The mutant lifestyle was under attack. Public perception of mutants was still not perfect, Charles Xavier’s dream of peaceful coexistence was still just out of reach. Sure, cooperative human-mutant teams like Force Works helped. X-Corp was dissolved.
The Washington DC riots and the attack on Mutant Town were still very fresh in everyone’s mind. Mutants had very few positive public faces other than the two official, but separate, factions of X-Men.
While Adam was completely lost in his thoughts, he failed to see Bobby Drake exit the locker room, adorned with a hoodie and jeans, fresh from a Danger Room session.
“Whoa,” Iceman exclaimed with a smile. He unconsciously held his arms outward to corral the wayward student. “Sorry about that. Uh…Adam, right?”
Adam returned the smile in an attempt to seem empathetic, “Yes, Professor Drake. Sorry. Didn’t mean to almost run you over.”
You stupid idiot, you barely understand the power you wield…Adam thought to himself, regarding the omega-level potential Iceman could attain. The DNA of an omega-level mutant was unique. Adam could see it almost instantly.
Iceman seemed irked by the title, but more pressing matters were at hand, “Well, not that I’m going to come down hard on new students, but…this entire area is for senior staff only when we aren’t on lockdown.”
Adam raised both eyebrows, “Oh. I see. I was actually meeting Professor McCoy. I’m doing an independent study this semester to make up some credits since I was a little late during admissions.”
Iceman looked towards the Cerebro chamber door, a large circular door crossed with an X, and then back at Adam, “Beast’s lab is on the opposite end. And I think he’s off-campus today, actually.” He crossed his arms, “I think you better return to the dorms.”
Adam nodded his head slightly, looking to the side, “I’m sorry. I was just…”
“I’m trying really hard not to judge you, Adam,” Iceman said. “Being an X-Man is exciting, and you might be a little too eager to rush through your degree…you need to clock in Danger Room credits, flight simulator hours, combat training…a bunch of extra—”
“You misunderstand,” Adam said. “I heard rumors that my…father…died here at the mansion*. I’m really sorry for snooping. I was just looking for…his body. I know he was your enemy…I just needed to understand.”
*(As seen in Cable/Deadpool #5, by yours truly—Brad)
Bobby sympathetically patted Adam on the back, “I’m sorry, buddy. From what I know, your dad’s remains sort of dissolved after he died…”
Characteristic of a clone, Adam thought. But he knew his father’s death was the only thing that would initiate his “birth” as a failsafe against finally ridding the world of the Clan Akkaba.
“I also wanted to see Cerebro in action,” Adam said matter-of-factly. “Just to gain insight. Know my place in the world. I used to look normal, but then my mutation hit and…I was just getting used to it. I didn’t get my powers during the start of puberty like normal mutants do.”
“Uh…,” Iceman looked back at the chamber door again, “we try not to run it too often. It is killer on the electric grid, but, I guess one quick look won’t hurt. This is a one-time deal, alright?”
Adam smiled, “Of course.”
Adam walked down a long corridor with the X-Men’s subbasement, located deep under the mansion. The seams of the walls, ceilings, and floor were clean, the colors were a subtle metallic blue. The lights were bright, but soft and calm. They hummed ever so slightly.
At the end of the hall was the Cerebro chamber. The mutant-tracking and operating system was accessible from various hubs throughout the mansion, but Adam needed the main hub for an uninterrupted—and untraceable—session. With Cerebro at his fingertips, he could track the entire Clan Akkaba, provided they were not blocking their psi-patterns.
The X-Men were too ethical to use Cerebro in such a voyeuristic nature. If they were not as ethical, they could preemptively attack and stop their enemies.
The mutant lifestyle was under attack. Public perception of mutants was still not perfect, Charles Xavier’s dream of peaceful coexistence was still just out of reach. Sure, cooperative human-mutant teams like Force Works helped. X-Corp was dissolved.
The Washington DC riots and the attack on Mutant Town were still very fresh in everyone’s mind. Mutants had very few positive public faces other than the two official, but separate, factions of X-Men.
While Adam was completely lost in his thoughts, he failed to see Bobby Drake exit the locker room, adorned with a hoodie and jeans, fresh from a Danger Room session.
“Whoa,” Iceman exclaimed with a smile. He unconsciously held his arms outward to corral the wayward student. “Sorry about that. Uh…Adam, right?”
Adam returned the smile in an attempt to seem empathetic, “Yes, Professor Drake. Sorry. Didn’t mean to almost run you over.”
You stupid idiot, you barely understand the power you wield…Adam thought to himself, regarding the omega-level potential Iceman could attain. The DNA of an omega-level mutant was unique. Adam could see it almost instantly.
Iceman seemed irked by the title, but more pressing matters were at hand, “Well, not that I’m going to come down hard on new students, but…this entire area is for senior staff only when we aren’t on lockdown.”
Adam raised both eyebrows, “Oh. I see. I was actually meeting Professor McCoy. I’m doing an independent study this semester to make up some credits since I was a little late during admissions.”
Iceman looked towards the Cerebro chamber door, a large circular door crossed with an X, and then back at Adam, “Beast’s lab is on the opposite end. And I think he’s off-campus today, actually.” He crossed his arms, “I think you better return to the dorms.”
Adam nodded his head slightly, looking to the side, “I’m sorry. I was just…”
“I’m trying really hard not to judge you, Adam,” Iceman said. “Being an X-Man is exciting, and you might be a little too eager to rush through your degree…you need to clock in Danger Room credits, flight simulator hours, combat training…a bunch of extra—”
“You misunderstand,” Adam said. “I heard rumors that my…father…died here at the mansion*. I’m really sorry for snooping. I was just looking for…his body. I know he was your enemy…I just needed to understand.”
*(As seen in Cable/Deadpool #5, by yours truly—Brad)
Bobby sympathetically patted Adam on the back, “I’m sorry, buddy. From what I know, your dad’s remains sort of dissolved after he died…”
Characteristic of a clone, Adam thought. But he knew his father’s death was the only thing that would initiate his “birth” as a failsafe against finally ridding the world of the Clan Akkaba.
“I also wanted to see Cerebro in action,” Adam said matter-of-factly. “Just to gain insight. Know my place in the world. I used to look normal, but then my mutation hit and…I was just getting used to it. I didn’t get my powers during the start of puberty like normal mutants do.”
“Uh…,” Iceman looked back at the chamber door again, “we try not to run it too often. It is killer on the electric grid, but, I guess one quick look won’t hurt. This is a one-time deal, alright?”
Adam smiled, “Of course.”
#3 - "TIPPING POINT"
Previously:
Adam Essex battled Enyalius—the First Horseman of Apocalypse—on the Greek island of Kos and had to get bailed out by his friends Sabretooth and Threnody. The resulting battle resulted in a volcanic eruption, causing Enyalius to flee and protect his ageless family, trapped in a time bubble by Apocalypse thousands of years ago. Elsewhere, Frederick Slade tracked down Autumn Rolfson, hoping to recruit her son, William, into the Clan Akkaba to eventually replace the vacant Apocalypse. Later, after recovering from his wounds, Adam determined that Enyalius was infused with Apocalypse’s blood—which was why he mistook the ancient Horseman as one of his targeted foes. In order to throw the X-Men from his true mission, he decided to enroll at the Xavier Institute as “Adam Simmons” (with a slightly embellished history). Despite protests from Wolverine and Havok, Beast and Rogue were sympathetic and Adam was allowed to enroll at the school while continuing his murderous mission.
# # # # #
London.
12 Hours Later.
Ava Slade was Frederick’s youngest daughter. She was also Adam’s next target. After Enyalius nearly killed him and blew his cover, Adam had to ramp up his game—he had to throw Frederick off, emotionally. Frederick was the final target—he was the Clan Akkaba’s leader, who goes by the title of The Fittest.
Ava had black hair under a black hoodie, to hide her elfin ears. She also had opaque green eyes—like her father. Adam could surmise she had the same teleportation powers, the same powers Clarice Ferguson, the mutant known as Blink, inherited. Sabretooth had given him a weeks-long tutorial on how to combat a teleporter.
The best way was always through surprise.
Adam dove from the top of the apartment building of the Albany and landed in front of Ava on the street below, delivering an uppercut punch from an enlarged shape-shifted fist.
Ava was flung backwards, disappearing into a bright pink elliptical portal.
*BLINK*
She attempted to use her momentum by opening another portal behind Adam, but he caught her leg and flung her in the opposite direction. She nimbly flipped through the air and slid into another portal—forming instantly with the distinctive “blink” sound once more—mere centimeters from the surface of the apartment complex.
Adam arched an eyebrow and turned around slowly. Ava had reappeared and stood behind him a safe distance. Adam noticed her goth chique attire. She wiped blood from her nose, giving Adam a nasty look.
“I surmise you have been killing my family?” Ava asked. “Do you have a death wish, or do you think I’m just a bird who can’t defend herself?”
“I surmise you’ve watched Beetlejuice one too many times,” Adam growled. “I don’t have a death wish, but I think your family does.”
Ava sighed heavily, “I don’t even want to do this…”
“Little late for that, I’m afraid,” Adam said as his fingers coalesced into serrated blades on each hand, matching his pale skin tone.
Ava blurted out, “I get it.”
Adam was completely taken aback. Perhaps he was used to the stereotypical Clan Akkaba—so conceited and overconfident, convinced their superiority was entitled to them above all else. Or was Ava Slade simply a nihilist. Did she have the death wish?
Adam dropped his hands, returning them to their normal five-fingered appearance, almost laughing, “Now you’re just making this a chore. You’re not even going to verbally bash me?”
“Apocalypse killed your father,” Ava stated. “Now you’re tearing through the Clan. I myself, am daughter to the Fittest. So, I’ve got a giant target on my head. I get it.”
Adam seemed shocked, “I…”
“You’re obviously not Nathanial Essex. Taking us out by your lonesome, personally…that would be beneath him,” Ava said. “It wasn’t that difficult to figure out you’re his…clone? Son? Did he engineer you with himself and one of the endless clones he had caged up at one point or another? Seems like the Byron Trust had some interesting things happening…combining three sets of DNA into one…*”
*(See Generation X #33—Brad)
“None of your damn business,” Adam hissed with his pointed teeth visible.
Ava sympathetically nodded her head, “It’s okay. I just thought I’d give you the benefit of knowing that I didn’t blame you. You’re not stupid.” She adjusted her posture into a fighting stance, “Now, shall we finish this before Scotland Yard shows up?”
Adam’s eyes widened and fought back a grin.
Ava arched an eyebrow, pierced with a chrome ring, fighting back a similar grin.
{{Don’t let her in your head, kid,}} Sabretooth yelled through Adam’s earpiece. {{I swear I will rip out your throat if you are getting a boner right now! She could have ‘ported your head clean off yer body and been home in time fer fuckin’ tea—focus!}}
Adam’s smile disappeared.
It appears dear ol’ Dad did not adjust the raging hormones of a late teenager within me, Adam thought. I guess you just can’t fight nature!
Adam gritted his teeth and shoved his hands outward, stretching his sharpened arms ten yards in front of him at lightning speed, right at Ava’s head. She instantly—or instinctively—formed a portal in front of her head, with the exit directly behind her attacker.
Adam’s own bladed hands sliced through his neck, causing him to recoil. Ava then closed both portals, dismembering his hands. Adam growled as his acidic blood hissed against the sidewalk. Eventually his neck healed and his hands grew back with some willpower to coax them.
Ava deadpanned, “Did your dad fuck a xenomorph or something?”
{{It’s no use, she’s got the upper-hand now,}} Sabretooth commanded with frustration. {{Abort.}}
Adam clenched his jaw, muttering, “I’ve got this…”
Ava smirked, “Talking with your teacher? What’s his name? Creed? I’ve got to say, it was a good idea getting your dad’s lapdog to tutor you. Too bad he didn’t teach you about me.”
Adam smirked, “There’s the verbal bashing. You lose.”
Before Ava could react, it was too late. Adam had been shifting his cells, down to his very DNA, within his eyes, causing an acute bioluminescence within them. His opaque red eyes grew brighter, then shifted into yellow, then violet, the most intense frequency possible.
The flash was brief, but effective.
Ava attempted to shield her eyes, but the damage to her vision was done. And without vision, a teleporter, even a long-distance teleporter like Ava, was powerless. Like a bird without flight.
“No…” she squealed as she swung her arms erratically, connecting with nothing but air. “Please no! NO!”
Adam ran towards her and jumped with his leg outstretched. The flying kick connected with her stomach, which he followed with a foot sweep knocking her on her back. Adam positioned his forearm across her throat.
“P-Please!” Ava choked as tears welled in her eyes from the pain that shot through her entire body from the force in which her spine hit the pavement.
Adam forced his forearm down, restricting Ava’s airway slowly, “You said so yourself…you understood why you have to die. Why you ALL have to die!”
“D-do you understand…?” Ava asked, her words without any breath behind them, they sounded like a faint squeak. Blood poured out of her nose and the sides of her mouth.
Adam suddenly stopped applying pressure to her throat, but still had Ava firmly pinned down, “What?”
“You don’t have to do this!” Ava pleaded. “Do you even know why you feel revenge? How do you know that wasn’t simply genetically programmed or some kind of implanted psionic suggestion? The Clan is a formality—to add structure to the chaos of Apocalypse’s offspring. With Apocalypse dead, they are directionless…”
“All the more reason for me to put the lot of you out of your misery…you serve no evolutionary purpose except to disrupt the natural order!” Adam bellowed with the conviction of his father behind his words.
Were they his words? Was Sinister just as twisted as Apocalypse. He disrupted the natural order, too.
A flash of green energy suddenly and violently propelled Adam across the street, where he skidded to a halt. Before him was a large man in a dark crimson cloak. He flicked his wrist and a Medieval sword slid into his hand from inside the sleeve. A similarly-sized man helped Ava to her feet.
The bodyguards had arrived.
“Are you alright, your Ladyship?” the guard asked as Ava wiped the tears from her eyes. She blinked a few times. Her vision was blurry, but it seemed like it was returning. Adam’s attack was temporary, at least.
She watched Adam across the street, “Yes, thank you, Augustine.”
Most important figures had intimidating men in suits with sunglasses as their personal security, but the Clan Akkaba had a secret service of men in Dungeons & Dragons costumes. Go figure.
Adam rolled on his back, noticing the rotting and burnt flesh above his ribcage. He ignored the injury and instead focused his attention on the large sword coming for him. He ducked his head, but did not account for the pointed cross guard of the sword and suddenly felt the flesh on his neck get ripped apart for the second time. His hands immediately went for his throat to try and stop the bleeding. His own hands were immune to his blood’s innate acidity.
That was when the burning rage inside of Adam erupted…like the volcano on Kos that he witnessed weeks earlier.
As long as their bloodline exists, Apocalypse will always have a backup plan for himself to return—to unabashedly jump start evolution in his own image by destroying the world, never allowing science to progress…
Sinister’s words—his father’s words—echoed in Adam’s head.
I’m not simply your monster to control from beyond the grave, Father…, he thought. I am a living, breathing man, a SENTIENT being…I HOLD THE PUPPET STRINGS! NOT YOU!
The sword-wielder had a broad backswing, ready to deliver the killing blow. As he swung, however, Adam grabbed the blade with his bare hand, bending the metal until the weapon broke. Without missing a beat, Adam clamped down on his tongue, biting it off with his razor-sharp teeth. He spit his acidic blood into the guard’s face, searing the flesh and burning his eyes. The cloak that covered his head simply smoldered as the guard simply fell over, dead.
Adam then shouted into the heavens with his clenched fists raised upwards. The diamond marking on his forehead and his eyes lit up with an eerie crimson glow. A shockwave of an invisible force emanated outwards with Adam at its epicenter. He could feel his psionic dead zone expand. He never attempted to do it before.
The shockwave pulsed outward, hitting Ava and Augustine, her cloaked bodyguard. The invisible shockwave continued outwards in a radius of a few miles. The physical effect was none, but the mental effect was clear.
Augustine looked down at his hands. The green bio-blast he was gifted with would not ignite and his enhanced musculature wained, “What…?”
His powers were cancelled out.
“I’m…I’m sorry M’Lady,” he trembled as he de-cloaked and fled in the opposite direction.
“You bloody coward…,” Ava grumbled as she ran a hand through her hair. She placed her hands on her hips as Adam approached her.
“Nice trick,” she said. “Canceling out mutant powers certainly makes you even more dangerous…I can’t believe he just left me like that…”
Adam elongated his index finger into a large blade, barely touching Ava’s throat. He gritted his teeth.
{{Finish it!}} Sabretooth yelled.
Adam grabbed his earpiece and smashed it under his heel, causing Ava to jump. He looked at Ava and returned his finger to normal. Her vision continued to return to normal to the point where she noticed Adam was fuming with rage, but his visage made it seem he was more hurt and conflicted than he realized.
And yet, Ava was oddly enchanted by the man who tried to kill her, “What’s your name?”
Adam allowed his tongue to fully grow back before he spoke. His voice was raw and gravelly from shouting, “You’re free to go…get out of here before I change my mind.”
He slowly walked backwards until a tesseract portal opened, “My name is Adam.”
Adam continued backwards and disappeared into he portal—leaving Ava alone. Her powers seemed to slowly activate as the effect of Adam’s dead zone dissipated. Her eyes lingered on the unique teleportation signature before disappearing into a portal of her own.
Enyalius the First Horseman silently watched from the rooftop of a nearby building. His own powers slowly re-emerged from the dead zone pulse. Leathery wings shot out of his large spiked back and the behemoth monstrosity took to the skies with an inhuman growl.
# # # # #
The Domicilium.
England.
“So this is Casa de Akkaba?” Autumn Rolfson asked. Her teenaged son, William, found himself enchanted by the sheer scale of the mansion. Over millennia, the family of Apocalypse amassed a melting pot of various cultures. The decor of the mansion reflected that wholeheartedly, with Egyptian hieroglyphs decorating the marble and gold-trimmed walls, Greek vases and mosaics, Sumatran statues depicting the various incarnations of En Sabah Nur, Ethiopian pottery, Renaissance artwork, and of course Roman and British architectural elements.
Frederick Slade held his arms outward, “Welcome to the Domicilium. This residence has been here in secret for centuries. One day, William, this will be your castle.”
William seemed embarrassed by the attention. He blushed, while physically manifesting an orange glow from the internal combustion occurring in his body, “Seems a bit much.”
Frederick laughed, “Yes, very true! Materialism is not a necessity for the strong. En Sabah Nur’s exuberant lifespan and long travels have simply assembled into a collection of treasures. And he needed a large enough dwelling to house it all!”
Autumn rolled her eyes, “He’s a child, but he’s not that stupid.”
“Mom!” William shot back. “I’m practically eighteen.”
“Yes, I know, honey,” Autumn sighed. “Your ferns are dead, by the way, Freddie. Sorry. I guess you can’t take me anywhere.”
“Damn, I got those from the Savage Land. No bother.” Frederick frowned at the lifeless brown husks drooped downwards from the pots. “Let’s go. I’ve something to show you!”
“Oh, joy! Will we get to pester the servants next?” Autumn deadpanned.
“No, we will be showing young William here his birthright,” Frederick said with a smile.
“Honey!” Autumn said with feigned excitement, grabbing her son’s forearm, “You’re going to get your own jackal statue and mummified beetles!”
“Your sarcastic wit is an intriguing defense mechanism, Lady Famine,” Frederick said. He walked through the foyer and stopped at an elevator. The gold-plated door slid open. Inside was a crystalline armor in the shape of a massive figure, comprised of Celestial technology.
William seemed instantly drawn to the armor, “Is that…mine?”
Frederick smiled, “Absolutely. We knew you’d be thrilled with it. It is attuned to your body’s natural harmonics.”
William walked up to the armor, which towered over him almost a full meter, and touched it. The constant fire and energy within him seemed to melt into the armor.
“Is this the icing on the cake?” Autumn wondered. “What other temptations are there around the corner?”
“Funny you should ask,” Frederick said. He raised his voice, “Cynbel? Come.”
A gray-skinned elderly man with hallow eyes blindly walked up to them, startling Famine. He wore a death shroud, quickly disrobing in front of them. The Mark of Akkaba was tattooed to his chest.
“Cynbel is four-hundred years old,” Frederick explained. “He has loyally served this family for centuries and ensured its growth by siring my various cousins, but now it is time to cull the weak from the strong.”
William seemed confused, “So…what do you want me to do?”
“Simple,” Frederick said. “Kill him.”
“I can’t just kill him, especially if he’s a family member…” William said without taking his hand from the crystalline armor.
Frederick raised his eyebrows, “Did you not hear me when I said this man was four-hundred years old? Well, 407 to be exact. Cynbel has lived a long life. He is kept alive with various herbal baths and artificial organics. He is weak. If you go to the market and you come upon a crate of apples, and one of those apples is overripe with white fuzz growing on it, wouldn’t you be disgusted with the entire crate?”
William paused, but nodded, “I guess.” The armor made his skin vibrate with pleasure to the point where he seemed completely synchronized with it body, mind, and soul.
“The only solution is to remove the moldy fruit, then,” Frederick stated.
William’s eyes glowed yellow, his skin became translucent and revealed his skeletal structure against the backdrop of pure microwave bio-energy. The armor silently opened itself to him.
“I…”
“Kill the invalid,” Frederick commanded as he shielded his eyes. “You will be first in line to ascend to the Fittest, ruler of this house and of this Clan.”
William was breathing heavily now as he stepped into the armor—which immediately closed behind him. The crystal behemoth exploded with light before dampening down to a soft yellow glow. Within the face plate, only William’s skull was visible.
He uttered with ecstasy within the containment suit as he became an energy being, “Oh my God…oh, fuck!”
Autumn arched an eyebrow, “Is he…? This is getting weird. William, get out of there!”
“NO!” he shouted. He raised his massive arm, fashioned into a cannon, pointed directly at Cynbel’s winkled and saggy-jowled face. He laughed as he expelled the energy. The headless body fell over.
William fell to his knees, exhaling repeatedly with pleasure as if he lost his virginity, “Heh. Haha. Goddamn, that felt GOOD!”
“You’ve done your father proud, William…or should I say…Genocide?” Frederick asked.
Autumn’s mouth was agape in shock. Never in a million years would she have suspected her once gentle child to take to cold-blooded murder as if he were born to do it.
“Genocide…I like it!”
Ava Slade watched from the shadows, having just teleported home after being nearly murdered by the boogeyman serial killer that has been targeting her family for months. Now, she witnessed that same family kill one of its elders for no apparent reason.
“Fuck this,” she muttered.
# # # # #
Central Omaha Lab.
//GTAACTACCAGCCCTAGCTAGCTAG//AAAGGCTCTATCTAGCTAGATCAAAAGAG//
Ava Slade, you minx. Your genetic code…it’s intoxicating…is this what one normally feels when there’s an attraction—or is this simply a desire to reproduce? Granted, no one can sense DNA like I can. Perhaps that’s where instinct comes in, does the dirty work, while I’m cursed with consciously reading every genetic marker.
Our offspring, son or daughter, would be…perfect. Perish the thought—me, a father? A monster giving life to an equally-grotesque being?
GTAACTACCAGCCCTAGCTAGCTAG//AAAGGCTCTATCTAGCTAGATCAAAAGAG//XXXX
Wait…
Maybe I was a bit hasty.
——XXX///XXXXX////XXXXXXX///////////////////////////////////////
It appears our offspring—in any combination of genes—would have a ninety-five percent chance of being stillborn, a pile of genetic mush.
Perhaps the fact that I am an engineered being has something to do with it, or the genetic tampering Apocalypse subjected to my father had unforeseen consequences regarding procreation with the Akkaba line?
Yes.
That is precisely it.
//GATACCCAGGAXXGACCCAAACAGATTAXAXX//XXX//GACTACAGTTTCGGAAAX//
The genetic anomaly originates from my DNA, which suggests that there was something within my father which could not be corrected for my ‘birth’ — for lack of a better term.
Wait.
If I could somehow engineer this protein anomaly to my advantage…it would render any of the Clan dead within minutes! My retrovirus will do the dirty work…and I can live my life without my father pulling the strings from beyond the grave.
“Adam?”
He swiveled his metallic chair and turned his head, meeting eyes with Threnody, “Yeah?”
Pink necroplasmic energy encircled her. Her eyes were completely illuminated, “Do you mind telling me what plan you’ve cooked up?”
The slight grin from his new project disappeared, “Sorry. I forgot how sensitive your powers can be—even potential death energy can cause them to spike.”
“Is it as big as it feels?” she asked.
Adam couldn’t help but nod, “I’ve just discovered a way to end this, once and for all. I barely have to lift a finger. It’s a shame, really. All that time training under Creed basically was all for nothing.”
“Not a total waste,” Threnody said.
“I’m still not sure if it will even work,” Adam said. “But if it does, our little trio might get disbanded quicker than originally thought.”
“There’s still Enyalius out there, looking for us,” Threnody warned.
“By then, I’m sure I’ll be fully in the grasp of the X-Men’s ranks,” Adam said with a smile.
“There’s still Creed and I, emphasis on I—me!” Threnody said with her arms crossed. “And you’d stay with the X-Men?”
Adam shrugged, “Why not? I like the prospect of using my talents in other ways right under the noses of the mutant authority. They’re itching to use me in the field, they just don’t realize it yet.”
“Except they’re technically a self-appointed authority,” Threnody corrected.
[[PROXIMITY ALERT—]]
“What?!” Adam spat as he leapt from his chair. “That’s impossible!”
*BLINK*
Ava Slade held her hands up, “Sorry for the intrusion, but I think we ought to have a chat!”
“You read my teleportation frequency, you minx,” Adam scowled.
Ava curled her lips into a wry smile, “I’ll take that as a compliment, you cunt.”
“One flinch, and you’re dead,” Threnody warned as she clenched her fists.
“Do you know who my father is?” Ava asked. “Frederick Slade? Fittest of the Clan Akkaba.”
Adam nodded grimly, “Most definitely.”
“I could send out a message to the entire Clan to converge onto this location,” Ava said. “Or just suck you all into a portal into the Earth’s core.”
Sabretooth leapt with a roar, tackling Ava to the ground and pinning her windpipe. He smiled as he raised his clawed hand, ready to bring it down across her throat, “Not so fast…”
He stopped, his extended claws returned into his fingertips.
“…Clarice?”
Ava coughed as Sabretooth backed away slowly, releasing her, “Like I said…just wanted to talk. Ms. Ferguson is a…distant relative.”
“Without the lavender skin, you look just like her after a Hot Topic shopping spree,” Sabretooth muttered. Ever since Milwaukee, he couldn’t bare the thought of strangling Clarice. Not again.
“You want to talk?” Adam asked. His teeth were predatory, despite his attraction to her, they had shape-shifted into miniature daggers, mirroring his defensive demeanor, “Talk.”
“My father has been courting some boy and his mother to join the Clan,” Ava explained. “The boy used some kind of crystal armor and melted the head off one of the Clan elders. He had some kind of skull for a face.”
“Crystal armor? Holocaust?” Threnody wondered.
Adam shook his head, “Nate Grey killed him.”
“Maybe not the one from this reality…,” Sabretooth said.
“My father called him Genocide,” Ava said. “Said he was next in line to take over the Clan, being a direct descendant of Apocalypse.”
“Why are you telling us this?” Threnody asked. “Are you planning some kind of weak-ass double-cross down the line?”
Ava shook her head, “I’m done with the family business.” She looked at Adam, “I think that’s why you decided not to kill me, because you saw that, too? I’m a bit nihilist, but only on a Brit cynic-level.”
Adam scowled. He was already giving the Summers-Grey Family a pass, along with the Starsmores and Fergusons. Now a Slade?
He sighed, “We have to trust her. I didn’t account for a nuclear deterrent like Genocide. We’ll need all the help we can get.”
Sabretooth placed his hands on his hips, looking downward, “We gotta keep this quiet, girl. We’ve been at this for awhile, targeting the Clan. We can’t have a teenaged wildcard like you disrupting the plan just because you suddenly got daddy issues at the drop of a hat.”
Ava’s brow furrowed, “Trust me. The hat dropped long ago. My last boyfriend was flayed and the two before that were thrown into some kind of fiery pit. And those were the mutant ones. Having a hundred-year-old xenophobic British dad isn’t exactly aces.”
“Oh, and a crazy unbeatable Dragon-Horseman is after us,” Threnody said.
“You woke Enyalius?” Ava groaned. “Dude…”
“Still wanna join us?” Sabretooth grinned.
“Enyalius is a minor setback,” Adam assured. “It’s messy, but it doesn’t sound like he’s got a lot of love for Apocalypse either.”
Ava rolled her eyes, “Fine. I gotta take a piss.”
“Brilliant! Threnody, show Ava the…the lady toilet, yeah?” Adam asked.
“Lady toilet,” Threnody retorted as she showed Ava the way.
As the two left the room, Adam glared at Sabretooth, “No more exceptions to the kill list.”
Sabretooth chuckled, “I know Clarice is safe by me helping you, but I don’t think you’re that upset Ava defected to our side.”
“Side?” Adam inquired. “This isn’t good and evil…this is purging fire. I’m doing this for the sake of natural order. Which reminds me, I guess I need to come up with some kind of inoculant to the retrovirus I plan to unleash to target and kill anyone related to Apocalypse.”
Sabretooth arched an eyebrow, “You wouldn’t prefer to slit their throats in the heat of battle?”
“Yes, but I didn’t figure out my blood held the key to killing all of them much more easily until just a few minutes ago,” Adam said with a shrug.
“Yeah, well, figure out how that won’t kill Clarice and I’ll be sure not to strangle you to death.” Sabretooth shook his head and muttered as he walked away, “Kids are so fucking lazy these days. No fun. No fun at all.”
# # # # #
Next Issue: Adam thinks he’s got the easy way out of his mission by releasing his virus against the Clan Akkaba, he just has to do it with the X-Men noticing. And it might be a fruitless effort if Genocide breaks rank and just nukes all of England to appease his dead dad! Stay tuned!
Adam Essex battled Enyalius—the First Horseman of Apocalypse—on the Greek island of Kos and had to get bailed out by his friends Sabretooth and Threnody. The resulting battle resulted in a volcanic eruption, causing Enyalius to flee and protect his ageless family, trapped in a time bubble by Apocalypse thousands of years ago. Elsewhere, Frederick Slade tracked down Autumn Rolfson, hoping to recruit her son, William, into the Clan Akkaba to eventually replace the vacant Apocalypse. Later, after recovering from his wounds, Adam determined that Enyalius was infused with Apocalypse’s blood—which was why he mistook the ancient Horseman as one of his targeted foes. In order to throw the X-Men from his true mission, he decided to enroll at the Xavier Institute as “Adam Simmons” (with a slightly embellished history). Despite protests from Wolverine and Havok, Beast and Rogue were sympathetic and Adam was allowed to enroll at the school while continuing his murderous mission.
# # # # #
London.
12 Hours Later.
Ava Slade was Frederick’s youngest daughter. She was also Adam’s next target. After Enyalius nearly killed him and blew his cover, Adam had to ramp up his game—he had to throw Frederick off, emotionally. Frederick was the final target—he was the Clan Akkaba’s leader, who goes by the title of The Fittest.
Ava had black hair under a black hoodie, to hide her elfin ears. She also had opaque green eyes—like her father. Adam could surmise she had the same teleportation powers, the same powers Clarice Ferguson, the mutant known as Blink, inherited. Sabretooth had given him a weeks-long tutorial on how to combat a teleporter.
The best way was always through surprise.
Adam dove from the top of the apartment building of the Albany and landed in front of Ava on the street below, delivering an uppercut punch from an enlarged shape-shifted fist.
Ava was flung backwards, disappearing into a bright pink elliptical portal.
*BLINK*
She attempted to use her momentum by opening another portal behind Adam, but he caught her leg and flung her in the opposite direction. She nimbly flipped through the air and slid into another portal—forming instantly with the distinctive “blink” sound once more—mere centimeters from the surface of the apartment complex.
Adam arched an eyebrow and turned around slowly. Ava had reappeared and stood behind him a safe distance. Adam noticed her goth chique attire. She wiped blood from her nose, giving Adam a nasty look.
“I surmise you have been killing my family?” Ava asked. “Do you have a death wish, or do you think I’m just a bird who can’t defend herself?”
“I surmise you’ve watched Beetlejuice one too many times,” Adam growled. “I don’t have a death wish, but I think your family does.”
Ava sighed heavily, “I don’t even want to do this…”
“Little late for that, I’m afraid,” Adam said as his fingers coalesced into serrated blades on each hand, matching his pale skin tone.
Ava blurted out, “I get it.”
Adam was completely taken aback. Perhaps he was used to the stereotypical Clan Akkaba—so conceited and overconfident, convinced their superiority was entitled to them above all else. Or was Ava Slade simply a nihilist. Did she have the death wish?
Adam dropped his hands, returning them to their normal five-fingered appearance, almost laughing, “Now you’re just making this a chore. You’re not even going to verbally bash me?”
“Apocalypse killed your father,” Ava stated. “Now you’re tearing through the Clan. I myself, am daughter to the Fittest. So, I’ve got a giant target on my head. I get it.”
Adam seemed shocked, “I…”
“You’re obviously not Nathanial Essex. Taking us out by your lonesome, personally…that would be beneath him,” Ava said. “It wasn’t that difficult to figure out you’re his…clone? Son? Did he engineer you with himself and one of the endless clones he had caged up at one point or another? Seems like the Byron Trust had some interesting things happening…combining three sets of DNA into one…*”
*(See Generation X #33—Brad)
“None of your damn business,” Adam hissed with his pointed teeth visible.
Ava sympathetically nodded her head, “It’s okay. I just thought I’d give you the benefit of knowing that I didn’t blame you. You’re not stupid.” She adjusted her posture into a fighting stance, “Now, shall we finish this before Scotland Yard shows up?”
Adam’s eyes widened and fought back a grin.
Ava arched an eyebrow, pierced with a chrome ring, fighting back a similar grin.
{{Don’t let her in your head, kid,}} Sabretooth yelled through Adam’s earpiece. {{I swear I will rip out your throat if you are getting a boner right now! She could have ‘ported your head clean off yer body and been home in time fer fuckin’ tea—focus!}}
Adam’s smile disappeared.
It appears dear ol’ Dad did not adjust the raging hormones of a late teenager within me, Adam thought. I guess you just can’t fight nature!
Adam gritted his teeth and shoved his hands outward, stretching his sharpened arms ten yards in front of him at lightning speed, right at Ava’s head. She instantly—or instinctively—formed a portal in front of her head, with the exit directly behind her attacker.
Adam’s own bladed hands sliced through his neck, causing him to recoil. Ava then closed both portals, dismembering his hands. Adam growled as his acidic blood hissed against the sidewalk. Eventually his neck healed and his hands grew back with some willpower to coax them.
Ava deadpanned, “Did your dad fuck a xenomorph or something?”
{{It’s no use, she’s got the upper-hand now,}} Sabretooth commanded with frustration. {{Abort.}}
Adam clenched his jaw, muttering, “I’ve got this…”
Ava smirked, “Talking with your teacher? What’s his name? Creed? I’ve got to say, it was a good idea getting your dad’s lapdog to tutor you. Too bad he didn’t teach you about me.”
Adam smirked, “There’s the verbal bashing. You lose.”
Before Ava could react, it was too late. Adam had been shifting his cells, down to his very DNA, within his eyes, causing an acute bioluminescence within them. His opaque red eyes grew brighter, then shifted into yellow, then violet, the most intense frequency possible.
The flash was brief, but effective.
Ava attempted to shield her eyes, but the damage to her vision was done. And without vision, a teleporter, even a long-distance teleporter like Ava, was powerless. Like a bird without flight.
“No…” she squealed as she swung her arms erratically, connecting with nothing but air. “Please no! NO!”
Adam ran towards her and jumped with his leg outstretched. The flying kick connected with her stomach, which he followed with a foot sweep knocking her on her back. Adam positioned his forearm across her throat.
“P-Please!” Ava choked as tears welled in her eyes from the pain that shot through her entire body from the force in which her spine hit the pavement.
Adam forced his forearm down, restricting Ava’s airway slowly, “You said so yourself…you understood why you have to die. Why you ALL have to die!”
“D-do you understand…?” Ava asked, her words without any breath behind them, they sounded like a faint squeak. Blood poured out of her nose and the sides of her mouth.
Adam suddenly stopped applying pressure to her throat, but still had Ava firmly pinned down, “What?”
“You don’t have to do this!” Ava pleaded. “Do you even know why you feel revenge? How do you know that wasn’t simply genetically programmed or some kind of implanted psionic suggestion? The Clan is a formality—to add structure to the chaos of Apocalypse’s offspring. With Apocalypse dead, they are directionless…”
“All the more reason for me to put the lot of you out of your misery…you serve no evolutionary purpose except to disrupt the natural order!” Adam bellowed with the conviction of his father behind his words.
Were they his words? Was Sinister just as twisted as Apocalypse. He disrupted the natural order, too.
A flash of green energy suddenly and violently propelled Adam across the street, where he skidded to a halt. Before him was a large man in a dark crimson cloak. He flicked his wrist and a Medieval sword slid into his hand from inside the sleeve. A similarly-sized man helped Ava to her feet.
The bodyguards had arrived.
“Are you alright, your Ladyship?” the guard asked as Ava wiped the tears from her eyes. She blinked a few times. Her vision was blurry, but it seemed like it was returning. Adam’s attack was temporary, at least.
She watched Adam across the street, “Yes, thank you, Augustine.”
Most important figures had intimidating men in suits with sunglasses as their personal security, but the Clan Akkaba had a secret service of men in Dungeons & Dragons costumes. Go figure.
Adam rolled on his back, noticing the rotting and burnt flesh above his ribcage. He ignored the injury and instead focused his attention on the large sword coming for him. He ducked his head, but did not account for the pointed cross guard of the sword and suddenly felt the flesh on his neck get ripped apart for the second time. His hands immediately went for his throat to try and stop the bleeding. His own hands were immune to his blood’s innate acidity.
That was when the burning rage inside of Adam erupted…like the volcano on Kos that he witnessed weeks earlier.
As long as their bloodline exists, Apocalypse will always have a backup plan for himself to return—to unabashedly jump start evolution in his own image by destroying the world, never allowing science to progress…
Sinister’s words—his father’s words—echoed in Adam’s head.
I’m not simply your monster to control from beyond the grave, Father…, he thought. I am a living, breathing man, a SENTIENT being…I HOLD THE PUPPET STRINGS! NOT YOU!
The sword-wielder had a broad backswing, ready to deliver the killing blow. As he swung, however, Adam grabbed the blade with his bare hand, bending the metal until the weapon broke. Without missing a beat, Adam clamped down on his tongue, biting it off with his razor-sharp teeth. He spit his acidic blood into the guard’s face, searing the flesh and burning his eyes. The cloak that covered his head simply smoldered as the guard simply fell over, dead.
Adam then shouted into the heavens with his clenched fists raised upwards. The diamond marking on his forehead and his eyes lit up with an eerie crimson glow. A shockwave of an invisible force emanated outwards with Adam at its epicenter. He could feel his psionic dead zone expand. He never attempted to do it before.
The shockwave pulsed outward, hitting Ava and Augustine, her cloaked bodyguard. The invisible shockwave continued outwards in a radius of a few miles. The physical effect was none, but the mental effect was clear.
Augustine looked down at his hands. The green bio-blast he was gifted with would not ignite and his enhanced musculature wained, “What…?”
His powers were cancelled out.
“I’m…I’m sorry M’Lady,” he trembled as he de-cloaked and fled in the opposite direction.
“You bloody coward…,” Ava grumbled as she ran a hand through her hair. She placed her hands on her hips as Adam approached her.
“Nice trick,” she said. “Canceling out mutant powers certainly makes you even more dangerous…I can’t believe he just left me like that…”
Adam elongated his index finger into a large blade, barely touching Ava’s throat. He gritted his teeth.
{{Finish it!}} Sabretooth yelled.
Adam grabbed his earpiece and smashed it under his heel, causing Ava to jump. He looked at Ava and returned his finger to normal. Her vision continued to return to normal to the point where she noticed Adam was fuming with rage, but his visage made it seem he was more hurt and conflicted than he realized.
And yet, Ava was oddly enchanted by the man who tried to kill her, “What’s your name?”
Adam allowed his tongue to fully grow back before he spoke. His voice was raw and gravelly from shouting, “You’re free to go…get out of here before I change my mind.”
He slowly walked backwards until a tesseract portal opened, “My name is Adam.”
Adam continued backwards and disappeared into he portal—leaving Ava alone. Her powers seemed to slowly activate as the effect of Adam’s dead zone dissipated. Her eyes lingered on the unique teleportation signature before disappearing into a portal of her own.
Enyalius the First Horseman silently watched from the rooftop of a nearby building. His own powers slowly re-emerged from the dead zone pulse. Leathery wings shot out of his large spiked back and the behemoth monstrosity took to the skies with an inhuman growl.
# # # # #
The Domicilium.
England.
“So this is Casa de Akkaba?” Autumn Rolfson asked. Her teenaged son, William, found himself enchanted by the sheer scale of the mansion. Over millennia, the family of Apocalypse amassed a melting pot of various cultures. The decor of the mansion reflected that wholeheartedly, with Egyptian hieroglyphs decorating the marble and gold-trimmed walls, Greek vases and mosaics, Sumatran statues depicting the various incarnations of En Sabah Nur, Ethiopian pottery, Renaissance artwork, and of course Roman and British architectural elements.
Frederick Slade held his arms outward, “Welcome to the Domicilium. This residence has been here in secret for centuries. One day, William, this will be your castle.”
William seemed embarrassed by the attention. He blushed, while physically manifesting an orange glow from the internal combustion occurring in his body, “Seems a bit much.”
Frederick laughed, “Yes, very true! Materialism is not a necessity for the strong. En Sabah Nur’s exuberant lifespan and long travels have simply assembled into a collection of treasures. And he needed a large enough dwelling to house it all!”
Autumn rolled her eyes, “He’s a child, but he’s not that stupid.”
“Mom!” William shot back. “I’m practically eighteen.”
“Yes, I know, honey,” Autumn sighed. “Your ferns are dead, by the way, Freddie. Sorry. I guess you can’t take me anywhere.”
“Damn, I got those from the Savage Land. No bother.” Frederick frowned at the lifeless brown husks drooped downwards from the pots. “Let’s go. I’ve something to show you!”
“Oh, joy! Will we get to pester the servants next?” Autumn deadpanned.
“No, we will be showing young William here his birthright,” Frederick said with a smile.
“Honey!” Autumn said with feigned excitement, grabbing her son’s forearm, “You’re going to get your own jackal statue and mummified beetles!”
“Your sarcastic wit is an intriguing defense mechanism, Lady Famine,” Frederick said. He walked through the foyer and stopped at an elevator. The gold-plated door slid open. Inside was a crystalline armor in the shape of a massive figure, comprised of Celestial technology.
William seemed instantly drawn to the armor, “Is that…mine?”
Frederick smiled, “Absolutely. We knew you’d be thrilled with it. It is attuned to your body’s natural harmonics.”
William walked up to the armor, which towered over him almost a full meter, and touched it. The constant fire and energy within him seemed to melt into the armor.
“Is this the icing on the cake?” Autumn wondered. “What other temptations are there around the corner?”
“Funny you should ask,” Frederick said. He raised his voice, “Cynbel? Come.”
A gray-skinned elderly man with hallow eyes blindly walked up to them, startling Famine. He wore a death shroud, quickly disrobing in front of them. The Mark of Akkaba was tattooed to his chest.
“Cynbel is four-hundred years old,” Frederick explained. “He has loyally served this family for centuries and ensured its growth by siring my various cousins, but now it is time to cull the weak from the strong.”
William seemed confused, “So…what do you want me to do?”
“Simple,” Frederick said. “Kill him.”
“I can’t just kill him, especially if he’s a family member…” William said without taking his hand from the crystalline armor.
Frederick raised his eyebrows, “Did you not hear me when I said this man was four-hundred years old? Well, 407 to be exact. Cynbel has lived a long life. He is kept alive with various herbal baths and artificial organics. He is weak. If you go to the market and you come upon a crate of apples, and one of those apples is overripe with white fuzz growing on it, wouldn’t you be disgusted with the entire crate?”
William paused, but nodded, “I guess.” The armor made his skin vibrate with pleasure to the point where he seemed completely synchronized with it body, mind, and soul.
“The only solution is to remove the moldy fruit, then,” Frederick stated.
William’s eyes glowed yellow, his skin became translucent and revealed his skeletal structure against the backdrop of pure microwave bio-energy. The armor silently opened itself to him.
“I…”
“Kill the invalid,” Frederick commanded as he shielded his eyes. “You will be first in line to ascend to the Fittest, ruler of this house and of this Clan.”
William was breathing heavily now as he stepped into the armor—which immediately closed behind him. The crystal behemoth exploded with light before dampening down to a soft yellow glow. Within the face plate, only William’s skull was visible.
He uttered with ecstasy within the containment suit as he became an energy being, “Oh my God…oh, fuck!”
Autumn arched an eyebrow, “Is he…? This is getting weird. William, get out of there!”
“NO!” he shouted. He raised his massive arm, fashioned into a cannon, pointed directly at Cynbel’s winkled and saggy-jowled face. He laughed as he expelled the energy. The headless body fell over.
William fell to his knees, exhaling repeatedly with pleasure as if he lost his virginity, “Heh. Haha. Goddamn, that felt GOOD!”
“You’ve done your father proud, William…or should I say…Genocide?” Frederick asked.
Autumn’s mouth was agape in shock. Never in a million years would she have suspected her once gentle child to take to cold-blooded murder as if he were born to do it.
“Genocide…I like it!”
Ava Slade watched from the shadows, having just teleported home after being nearly murdered by the boogeyman serial killer that has been targeting her family for months. Now, she witnessed that same family kill one of its elders for no apparent reason.
“Fuck this,” she muttered.
# # # # #
Central Omaha Lab.
//GTAACTACCAGCCCTAGCTAGCTAG//AAAGGCTCTATCTAGCTAGATCAAAAGAG//
Ava Slade, you minx. Your genetic code…it’s intoxicating…is this what one normally feels when there’s an attraction—or is this simply a desire to reproduce? Granted, no one can sense DNA like I can. Perhaps that’s where instinct comes in, does the dirty work, while I’m cursed with consciously reading every genetic marker.
Our offspring, son or daughter, would be…perfect. Perish the thought—me, a father? A monster giving life to an equally-grotesque being?
GTAACTACCAGCCCTAGCTAGCTAG//AAAGGCTCTATCTAGCTAGATCAAAAGAG//XXXX
Wait…
Maybe I was a bit hasty.
——XXX///XXXXX////XXXXXXX///////////////////////////////////////
It appears our offspring—in any combination of genes—would have a ninety-five percent chance of being stillborn, a pile of genetic mush.
Perhaps the fact that I am an engineered being has something to do with it, or the genetic tampering Apocalypse subjected to my father had unforeseen consequences regarding procreation with the Akkaba line?
Yes.
That is precisely it.
//GATACCCAGGAXXGACCCAAACAGATTAXAXX//XXX//GACTACAGTTTCGGAAAX//
The genetic anomaly originates from my DNA, which suggests that there was something within my father which could not be corrected for my ‘birth’ — for lack of a better term.
Wait.
If I could somehow engineer this protein anomaly to my advantage…it would render any of the Clan dead within minutes! My retrovirus will do the dirty work…and I can live my life without my father pulling the strings from beyond the grave.
“Adam?”
He swiveled his metallic chair and turned his head, meeting eyes with Threnody, “Yeah?”
Pink necroplasmic energy encircled her. Her eyes were completely illuminated, “Do you mind telling me what plan you’ve cooked up?”
The slight grin from his new project disappeared, “Sorry. I forgot how sensitive your powers can be—even potential death energy can cause them to spike.”
“Is it as big as it feels?” she asked.
Adam couldn’t help but nod, “I’ve just discovered a way to end this, once and for all. I barely have to lift a finger. It’s a shame, really. All that time training under Creed basically was all for nothing.”
“Not a total waste,” Threnody said.
“I’m still not sure if it will even work,” Adam said. “But if it does, our little trio might get disbanded quicker than originally thought.”
“There’s still Enyalius out there, looking for us,” Threnody warned.
“By then, I’m sure I’ll be fully in the grasp of the X-Men’s ranks,” Adam said with a smile.
“There’s still Creed and I, emphasis on I—me!” Threnody said with her arms crossed. “And you’d stay with the X-Men?”
Adam shrugged, “Why not? I like the prospect of using my talents in other ways right under the noses of the mutant authority. They’re itching to use me in the field, they just don’t realize it yet.”
“Except they’re technically a self-appointed authority,” Threnody corrected.
[[PROXIMITY ALERT—]]
“What?!” Adam spat as he leapt from his chair. “That’s impossible!”
*BLINK*
Ava Slade held her hands up, “Sorry for the intrusion, but I think we ought to have a chat!”
“You read my teleportation frequency, you minx,” Adam scowled.
Ava curled her lips into a wry smile, “I’ll take that as a compliment, you cunt.”
“One flinch, and you’re dead,” Threnody warned as she clenched her fists.
“Do you know who my father is?” Ava asked. “Frederick Slade? Fittest of the Clan Akkaba.”
Adam nodded grimly, “Most definitely.”
“I could send out a message to the entire Clan to converge onto this location,” Ava said. “Or just suck you all into a portal into the Earth’s core.”
Sabretooth leapt with a roar, tackling Ava to the ground and pinning her windpipe. He smiled as he raised his clawed hand, ready to bring it down across her throat, “Not so fast…”
He stopped, his extended claws returned into his fingertips.
“…Clarice?”
Ava coughed as Sabretooth backed away slowly, releasing her, “Like I said…just wanted to talk. Ms. Ferguson is a…distant relative.”
“Without the lavender skin, you look just like her after a Hot Topic shopping spree,” Sabretooth muttered. Ever since Milwaukee, he couldn’t bare the thought of strangling Clarice. Not again.
“You want to talk?” Adam asked. His teeth were predatory, despite his attraction to her, they had shape-shifted into miniature daggers, mirroring his defensive demeanor, “Talk.”
“My father has been courting some boy and his mother to join the Clan,” Ava explained. “The boy used some kind of crystal armor and melted the head off one of the Clan elders. He had some kind of skull for a face.”
“Crystal armor? Holocaust?” Threnody wondered.
Adam shook his head, “Nate Grey killed him.”
“Maybe not the one from this reality…,” Sabretooth said.
“My father called him Genocide,” Ava said. “Said he was next in line to take over the Clan, being a direct descendant of Apocalypse.”
“Why are you telling us this?” Threnody asked. “Are you planning some kind of weak-ass double-cross down the line?”
Ava shook her head, “I’m done with the family business.” She looked at Adam, “I think that’s why you decided not to kill me, because you saw that, too? I’m a bit nihilist, but only on a Brit cynic-level.”
Adam scowled. He was already giving the Summers-Grey Family a pass, along with the Starsmores and Fergusons. Now a Slade?
He sighed, “We have to trust her. I didn’t account for a nuclear deterrent like Genocide. We’ll need all the help we can get.”
Sabretooth placed his hands on his hips, looking downward, “We gotta keep this quiet, girl. We’ve been at this for awhile, targeting the Clan. We can’t have a teenaged wildcard like you disrupting the plan just because you suddenly got daddy issues at the drop of a hat.”
Ava’s brow furrowed, “Trust me. The hat dropped long ago. My last boyfriend was flayed and the two before that were thrown into some kind of fiery pit. And those were the mutant ones. Having a hundred-year-old xenophobic British dad isn’t exactly aces.”
“Oh, and a crazy unbeatable Dragon-Horseman is after us,” Threnody said.
“You woke Enyalius?” Ava groaned. “Dude…”
“Still wanna join us?” Sabretooth grinned.
“Enyalius is a minor setback,” Adam assured. “It’s messy, but it doesn’t sound like he’s got a lot of love for Apocalypse either.”
Ava rolled her eyes, “Fine. I gotta take a piss.”
“Brilliant! Threnody, show Ava the…the lady toilet, yeah?” Adam asked.
“Lady toilet,” Threnody retorted as she showed Ava the way.
As the two left the room, Adam glared at Sabretooth, “No more exceptions to the kill list.”
Sabretooth chuckled, “I know Clarice is safe by me helping you, but I don’t think you’re that upset Ava defected to our side.”
“Side?” Adam inquired. “This isn’t good and evil…this is purging fire. I’m doing this for the sake of natural order. Which reminds me, I guess I need to come up with some kind of inoculant to the retrovirus I plan to unleash to target and kill anyone related to Apocalypse.”
Sabretooth arched an eyebrow, “You wouldn’t prefer to slit their throats in the heat of battle?”
“Yes, but I didn’t figure out my blood held the key to killing all of them much more easily until just a few minutes ago,” Adam said with a shrug.
“Yeah, well, figure out how that won’t kill Clarice and I’ll be sure not to strangle you to death.” Sabretooth shook his head and muttered as he walked away, “Kids are so fucking lazy these days. No fun. No fun at all.”
# # # # #
Next Issue: Adam thinks he’s got the easy way out of his mission by releasing his virus against the Clan Akkaba, he just has to do it with the X-Men noticing. And it might be a fruitless effort if Genocide breaks rank and just nukes all of England to appease his dead dad! Stay tuned!